Strumenti Utente

Strumenti Sito


playground:old:calamatta1

Amplificazione di specifiche regioni di DNA (via PCR)

La reazione a catena della polimerasi (PCR) è un metodo messo a punto da Kary Mullis nel 1983, che permette di ottenere grandi quantità di frammenti di DNA target, attraverso una loro selettiva amplificazione esponenziale. Questo metodo prevede l’utilizzo di oligonucleotidi fiancheggianti della sequenza target (detti primers), che fungono da inneschi del processo replicativo, a partire dal DNA genomico. Il processo replicativo che porta alla amplificazione del frammento di interesse (a) prevede ibridazione dei primers al DNA genomico che funge da stampo, (b) viene effettuato grazie a un enzima (la DNA polimerasi) termostabile (Taq polimerasi), © richiede la presenza di desossinucleotidi liberi che l’enzima utilizza nel processo replicativo, ovvero i monomeri dalla cui unione si ottiene il polimero DNA. Il processo replicativo viene effettuato utilizzando un termociclatore, ovvero uno strumento che garantisce l’opportuno e preciso controllo della temperatura, necessario in ogni fase del ciclo replicativo. p Gli impieghi di questa procedura sono molteplici, e includono la filogenesi molecolare, il barcoding molecolare e e l’uso diagnostico per identificare marcatori di patologie.

Un ciclo di PCR è costituito da tre fasi:

- Separazione dei filamenti (denaturazione) I due filamenti che costituiscono la doppia elica di DNA sono divisi alla temperatura di 94/95 °C per 30/60 secondi.

- Ibridazione dei primer (appaiamento) La soluzione viene raffreddata a 30°/65°C per poter permettere l’ibridazione di entrambi i primers con un filamento di DNA. La temperatura di appaiamento dipende da composizione e lunghezza del primer.

- Sintesi del DNA (estensione) La soluzione viene scaldata a 72 °C in modo che i primer non si stacchino. L’enzima a questo punto comincia a lavorare e “allunga” entrambi i primers, polimerizzando nucleotidi, nella direzione della sequenza bersaglio.

Nella reazione abbiamo utilizzato i primers che permettono l’amplificazione della regione del DNA mitocondriale codificante la proteina citocromo ossidasi (subunita I), ovvero COI. Questo frammento viene utilizzato negli animali per il barcoding.

Regione COI
Cicli per l'Amplificazione Temp Durata N. Cicli
Denaturazione 95°C 2' 1
Denaturazione 94°C 30“ 30
Appaiamento 54°C 30” 30
Estensione 72°C 1' 30
Estensione 72°C 10' 1

REAGENTI NECESSARI

  • H2O
  • Buffer
  • MgCl2 (necessario per il lavoro dell’enzima)
  • Deosssinucleotidi trifosfato (DNTP)
  • Primers, ossia regioni fiancheggianti (sui due filamenti) il frammento da amplificare e che rappresentano l’innesco per la replicazione.

Mix PCR

Reagenti Concentrazone reagenti Volume (µl)
H2O 7,73
Buffer 10x 1
MgCl2 50mM 0.3
Dntp 2,5mM 0.2
Primer Forward 100mM 0.1
Primer Reverse 100µM 0.1
Taq 5U/µl 0.07
Tot Mix 9,5
DNA 10-100ng 0,5
Tot 10

Primer utilizzati

COI FishF1 (forward) TCAACCAACCACAAAGACATTGGCAC Ward et al 2005
FishR2 (reverse) ACTTCAGGGTGACCGAAGAATCAGAA Ward et al 2005

Video pcr in italiano https://youtu.be/BF0XJ29AAGk

Video pcr in inglese https://youtu.be/iQsu3Kz9NYo

playground/old/calamatta1.txt · Ultima modifica: 2019/09/23 14:30 (modifica esterna)